multi resistant strain s aureus atcc baa 39 Search Results


insert set of genomes into species tree  (DOE Systems Biology Knowledgebase)
90
DOE Systems Biology Knowledgebase insert set of genomes into species tree
Insert Set Of Genomes Into Species Tree, supplied by DOE Systems Biology Knowledgebase, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+resistant+strain+s+aureus+atcc+baa+39/insert+set+of+genomes+into+species+tree+v2+1+10/pm32809929-46-29-26
Average 90 stars, based on 1 article reviews
insert set of genomes into species tree - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
geneious prime v 2026 0  (Biomatters Ltd)
86
Biomatters Ltd geneious prime v 2026 0
Geneious Prime V 2026 0, supplied by Biomatters Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+resistant+strain+s+aureus+atcc+baa+39/geneious+prime/pm41753713-73-13-17
Average 86 stars, based on 1 article reviews
geneious prime v 2026 0 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
comsol multi-physics  (COMSOL Inc)
90
COMSOL Inc comsol multi-physics
Comsol Multi Physics, supplied by COMSOL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+resistant+strain+s+aureus+atcc+baa+39/comsol+multiphysics/10__1021_slash_acsphotonics__6b00258-57-82-82
Average 90 stars, based on 1 article reviews
comsol multi-physics - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
multi-physics graphical user interface  (COMSOL Inc)
90
COMSOL Inc multi-physics graphical user interface
Multi Physics Graphical User Interface, supplied by COMSOL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+resistant+strain+s+aureus+atcc+baa+39/graphical+user+interface++gui+/sanni_kabir_oyekunle__2014__improved_depleting_sand_fracture_model-23-169-168
Average 90 stars, based on 1 article reviews
multi-physics graphical user interface - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
built-in application mode of static plane strain of comsol multiphysics  (COMSOL Inc)
90
COMSOL Inc built-in application mode of static plane strain of comsol multiphysics
Built In Application Mode Of Static Plane Strain Of Comsol Multiphysics, supplied by COMSOL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+resistant+strain+s+aureus+atcc+baa+39/built+in+application+mode+of+static+plane+strain+of+comsol+multiphysics/ppr0419583-92-43-42
Average 90 stars, based on 1 article reviews
built-in application mode of static plane strain of comsol multiphysics - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
paper n a saccharomyces cerevisiae strain y190  (Addgene inc)
93
Addgene inc paper n a saccharomyces cerevisiae strain y190
Figure 4. Gate mutations are sufficient to alter receptor basal signaling activity in planta Wild-type and mutated PYLs were expressed under the control of the AtPYL4 promoter in the ABA-deficient mutant <t>aba2-1.</t> Independent T1 plants were selected based on glufosinate-resistance and transplanted to soil alongside the Col-0 and aba2-1 controls. (A and C) Phenotype and fresh weight of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (A) or MpPYL1 (C). (B and D) Thermograph and leaf temperature of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (B) or MpPYL1 (D). Photographs were taken after 6 weeks of growth under short-day conditions (8/16 day/night). Different letters indicate statistically significant differences (Tukey HSD test, df = 3 [p < 0.01], for transgenic plants, n = 24; for Col-0 and aba2-1, n = 12). See also Figure S6 and Table S3 for com.
Paper N A Saccharomyces Cerevisiae Strain Y190, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+resistant+strain+s+aureus+atcc+baa+39/pTORKm43GWY+(Plasmid+%23112901)/pm39892384-531-133-169
Average 93 stars, based on 1 article reviews
paper n a saccharomyces cerevisiae strain y190 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
e. coli strain bl21 (de3) plyss  (Promega)
90
Promega e. coli strain bl21 (de3) plyss
Figure 4. Gate mutations are sufficient to alter receptor basal signaling activity in planta Wild-type and mutated PYLs were expressed under the control of the AtPYL4 promoter in the ABA-deficient mutant <t>aba2-1.</t> Independent T1 plants were selected based on glufosinate-resistance and transplanted to soil alongside the Col-0 and aba2-1 controls. (A and C) Phenotype and fresh weight of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (A) or MpPYL1 (C). (B and D) Thermograph and leaf temperature of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (B) or MpPYL1 (D). Photographs were taken after 6 weeks of growth under short-day conditions (8/16 day/night). Different letters indicate statistically significant differences (Tukey HSD test, df = 3 [p < 0.01], for transgenic plants, n = 24; for Col-0 and aba2-1, n = 12). See also Figure S6 and Table S3 for com.
E. Coli Strain Bl21 (De3) Plyss, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+resistant+strain+s+aureus+atcc+baa+39/e++coli+bl21+de3+plyss/pm39892384-531-20-21
Average 90 stars, based on 1 article reviews
e. coli strain bl21 (de3) plyss - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
del  (Eurofins)
86
Eurofins del
Figure 4. Gate mutations are sufficient to alter receptor basal signaling activity in planta Wild-type and mutated PYLs were expressed under the control of the AtPYL4 promoter in the ABA-deficient mutant <t>aba2-1.</t> Independent T1 plants were selected based on glufosinate-resistance and transplanted to soil alongside the Col-0 and aba2-1 controls. (A and C) Phenotype and fresh weight of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (A) or MpPYL1 (C). (B and D) Thermograph and leaf temperature of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (B) or MpPYL1 (D). Photographs were taken after 6 weeks of growth under short-day conditions (8/16 day/night). Different letters indicate statistically significant differences (Tukey HSD test, df = 3 [p < 0.01], for transgenic plants, n = 24; for Col-0 and aba2-1, n = 12). See also Figure S6 and Table S3 for com.
Del, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+resistant+strain+s+aureus+atcc+baa+39/d260+del+e258/pm37633273-165-96-118
Average 86 stars, based on 1 article reviews
del - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
ab110413  (Proteintech)
93
Proteintech ab110413
Figure 4. Gate mutations are sufficient to alter receptor basal signaling activity in planta Wild-type and mutated PYLs were expressed under the control of the AtPYL4 promoter in the ABA-deficient mutant <t>aba2-1.</t> Independent T1 plants were selected based on glufosinate-resistance and transplanted to soil alongside the Col-0 and aba2-1 controls. (A and C) Phenotype and fresh weight of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (A) or MpPYL1 (C). (B and D) Thermograph and leaf temperature of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (B) or MpPYL1 (D). Photographs were taken after 6 weeks of growth under short-day conditions (8/16 day/night). Different letters indicate statistically significant differences (Tukey HSD test, df = 3 [p < 0.01], for transgenic plants, n = 24; for Col-0 and aba2-1, n = 12). See also Figure S6 and Table S3 for com.
Ab110413, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+resistant+strain+s+aureus+atcc+baa+39/UQCRC1+Antibody/pm37633273-165-14-42
Average 93 stars, based on 1 article reviews
ab110413 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
aaactgagttagctctggtagtgcc origene cat  (OriGene)
94
OriGene aaactgagttagctctggtagtgcc origene cat
Figure 4. Gate mutations are sufficient to alter receptor basal signaling activity in planta Wild-type and mutated PYLs were expressed under the control of the AtPYL4 promoter in the ABA-deficient mutant <t>aba2-1.</t> Independent T1 plants were selected based on glufosinate-resistance and transplanted to soil alongside the Col-0 and aba2-1 controls. (A and C) Phenotype and fresh weight of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (A) or MpPYL1 (C). (B and D) Thermograph and leaf temperature of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (B) or MpPYL1 (D). Photographs were taken after 6 weeks of growth under short-day conditions (8/16 day/night). Different letters indicate statistically significant differences (Tukey HSD test, df = 3 [p < 0.01], for transgenic plants, n = 24; for Col-0 and aba2-1, n = 12). See also Figure S6 and Table S3 for com.
Aaactgagttagctctggtagtgcc Origene Cat, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+resistant+strain+s+aureus+atcc+baa+39/pCas-Scramble/pm37537841-266-257-258
Average 94 stars, based on 1 article reviews
aaactgagttagctctggtagtgcc origene cat - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results


Figure 4. Gate mutations are sufficient to alter receptor basal signaling activity in planta Wild-type and mutated PYLs were expressed under the control of the AtPYL4 promoter in the ABA-deficient mutant aba2-1. Independent T1 plants were selected based on glufosinate-resistance and transplanted to soil alongside the Col-0 and aba2-1 controls. (A and C) Phenotype and fresh weight of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (A) or MpPYL1 (C). (B and D) Thermograph and leaf temperature of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (B) or MpPYL1 (D). Photographs were taken after 6 weeks of growth under short-day conditions (8/16 day/night). Different letters indicate statistically significant differences (Tukey HSD test, df = 3 [p < 0.01], for transgenic plants, n = 24; for Col-0 and aba2-1, n = 12). See also Figure S6 and Table S3 for com.

Journal: Current biology : CB

Article Title: Abscisic acid receptors functionally converge across 500 million years of land plant evolution.

doi: 10.1016/j.cub.2024.12.043

Figure Lengend Snippet: Figure 4. Gate mutations are sufficient to alter receptor basal signaling activity in planta Wild-type and mutated PYLs were expressed under the control of the AtPYL4 promoter in the ABA-deficient mutant aba2-1. Independent T1 plants were selected based on glufosinate-resistance and transplanted to soil alongside the Col-0 and aba2-1 controls. (A and C) Phenotype and fresh weight of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (A) or MpPYL1 (C). (B and D) Thermograph and leaf temperature of Col-0, aba2-1, and aba2-1 mutants expressing wild-type and gate-mutated versions of PpPYL1 (B) or MpPYL1 (D). Photographs were taken after 6 weeks of growth under short-day conditions (8/16 day/night). Different letters indicate statistically significant differences (Tukey HSD test, df = 3 [p < 0.01], for transgenic plants, n = 24; for Col-0 and aba2-1, n = 12). See also Figure S6 and Table S3 for com.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. Coli strain DH5a N/A E. coli strain BL21 (DE3) ) pLysS Promega CAT#L1195 Chemicals, peptides, and recombinant proteins (+)-Abscisic acid CAS: 21293-29-8 G418 disulfate TOKU-E CAT#G001; CAS: 108321-42-2 IPTG CAS: 367-93-1 pNPP Sigma Aldrich CAT#487663; CAS: 36199-67-4 Imidasole Sigma Aldrich CAS: 288-32-4 b-Me Sigma Aldrich CAS: 60-24-2 DTT Sigma Aldrich CAS: 3483-12-3 Glufosinate-ammonium Sigma Aldrich CAT#45520; CAS: 77182-82-2 Methylumbelliferyl glucuronide CAS: 6160-80-1 Luminol CAS: 521-31-3 Critical commercial assays Ni-NTA agarose Cube biotech 31105 Gel filtration calibration kit LMW Cytiva 28403841 QuikChange Lightning Multi Site-Directed Mutagenesis Agilent 210515 Deposited data P. patens genome browser Perroud et al.36 N/A List of polypeptide sequences used in phylogenetic analysis This paper https://doi.org/10.5281/ zenodo.14506391 Experimental models: Organisms/strains Physcomitrium patens (Gransden strain) N/A Physcomitrium patens (Gransden strain) Pppyl1-4 This paper N/A saccharomyces cerevisiae strain Y190 (MATa, ade2-101, gal4, gal80, his3 -200, leu2-3,112 trp1 -901, ura3-52, URA3::GAL1-lacZ, lys2::GAL1-HIS3, cyhrs) N/A Arabidopsis thaliana (ecotype Col-0) N/A aba2-1 (Col-0 background) L eon-Kloosterziel et al.37 N/A Recombinant DNA pEn-Chimera Addgene ID: 61432 pMBL::Ubi-Cas-nos This paper N/A pHeGHPB Pri-Tal et al.35 N/A pMBL5::YFP This paper N/A pBM113Kp Knight et al.38 N/A pAct1-LUC McElroy et al.39 N/A pBD-GAL4 Cam Clontech N/A pACT2 Clontech N/A pET28 Novagen CAT#69864-3 Software and algorithms MAFFT (v.7.305b) Katoh and Standley40 N/A IQ-TREE multicore version 1.5.5 Nguyen et al.41 N/A Modelfinder Kalyaanamoorthy et al.42 N/A CRISPOR Concordet and Haeussler43 N/A FLIR Tools v5.2.15161.1001 software FLIR N/A (Continued on next page) e1 Current Biology 35, 1–13.e1–e4, February 24, 2025

Techniques: Activity Assay, Control, Mutagenesis, Expressing, Transgenic Assay